Dspp^em2Jpsi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dspp^em2Jpsi
• Name: dentin sialophosphoprotein; endonuclease-mediated mutation 2, James Simmer
• MGI ID: MGI:6715230
• Synonyms: Dspp^-DPP
• Gene: Dspp Location: Chr5:104318578-104327993 bp, + strand Genetic Position: Chr5, 50.59 cM
• Alliance: Dspp^em2Jpsi page

Mutation origin

• Strain of Origin: (C57BL/6N x SJL)F1

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: A single nucleotide was duplicated in the coding region of exon 5 (c.1380dupT) using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. This insertion creates a premature stop codon TAA and prevents translation of most of the sequence coding for the dentin phosphoprotein (DPP) domain. (J:326944)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dspp Mutation: 66 strains or lines available

References

• Original: J:326944 Liang T, et al., Mouse Dspp frameshift model of human dentinogenesis imperfecta. Sci Rep. 2021 Oct 19;11(1):20653
• All: 1 reference(s)