Zdhhc2^em1Eko
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zdhhc2^em1Eko
• Name: zinc finger, DHHC domain containing 2; endonuclease-mediated mutation 1, Eryan Kong
• MGI ID: MGI:6693324
• Gene: Zdhhc2 Location: Chr8:40876526-40946178 bp, + strand Genetic Position: Chr8, 23.89 cM
• Alliance: Zdhhc2^em1Eko page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNAs CAATGTTTGTCTGGTCATACTGG and TTGACACCCTAATGAAACGGAGG generated a 44 bp deletion in exon 3 and also part of intron 3. (J:303593)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Zdhhc2 Mutation: 19 strains or lines available

References

• Original: J:303593 Zhou B, et al., Zdhhc2 Is Essential for Plasmacytoid Dendritic Cells Mediated Inflammatory Response in Psoriasis. Front Immunol. 2020;11:607442
• All: 1 reference(s)