Mcu^em1Muma
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mcu^em1Muma
• Name: mitochondrial calcium uniporter; endonuclease-mediated mutation 1, Muniswamy Madesh
• MGI ID: MGI:6515815
• Synonyms: MCU-C96A-KI
• Gene: Mcu Location: Chr10:59282806-59452514 bp, - strand Genetic Position: Chr10, 29.55 cM
• Alliance: Mcu^em1Muma page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: A mutation that changes codon 96 from cysteine (TGC) to alanine (GCC) (p.C96A) was created with two gRNAS (targeting GAGAGCTGCGCTCGCGACGGTTA and AAGCCTATCTCTGACTCAGTCGG) and an ssODN template using CRISPR/Cas9 technology. The mutation mimics the human p.C97A gain-of-function mutation that results in a hyperactivated channel activity. (J:284475)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mcu Mutation: 27 strains or lines available

References

• Original: J:284475 Tomar D, et al., Blockade of MCU-Mediated Ca(2+) Uptake Perturbs Lipid Metabolism via PP4-Dependent AMPK Dephosphorylation. Cell Rep. 2019 Mar 26;26(13):3709-3725.e7
• All: 1 reference(s)