Gt(ROSA)26Sorem1(CAG-Ikzf2,-tdTomato)Zyliu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gt(ROSA)26Sorem1(CAG-Ikzf2,-tdTomato)Zyliu |
| Name: |
gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Zhiyong Liu |
| MGI ID: |
MGI:6515768 |
| Synonyms: |
Rosa26-CAG-Loxp-stop-Loxp-Ikzf2*3xHA-T2A-Tdtomato, Rosa26-CAG-LSL-Ikzf2 |
| Gene: |
Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
|
| Alliance: |
Gt(ROSA)26Sorem1(CAG-Ikzf2,-tdTomato)Zyliu page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Conditional ready, Epitope tag, Inserted expressed sequence, Reporter) |
| Mutation: |
|
Insertion
|
| |
|
Gt(ROSA)26Sorem1(CAG-Ikzf2,-tdTomato)Zyliu expresses
1 gene
|
| |
|
Gt(ROSA)26Sorem1(CAG-Ikzf2,-tdTomato)Zyliu expression driven by
1 gene
Knock-in expression driven by:
| Organism |
Driver Gene |
Note |
| chicken |
CAG |
|
|
| |
|
Mutation details: Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Ikzf2 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream.
(J:309477)
|
|
|
|
|
| Original: |
J:309477 Sun S, et al., Dual expression of Atoh1 and Ikzf2 promotes transformation of adult cochlear supporting cells into outer hair cells. Elife. 2021 Sep;:e66547 |
| All: |
2 reference(s) |
|