| Symbol: |
Igs7tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Tasic |
| Name: |
intergenic site 7; targeted mutation 175, Bosiljka Tasic |
| MGI ID: |
MGI:6514371 |
| Synonyms: |
Ai175, Igs7tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Hze |
| Gene: |
Igs7 Location: unknown Genetic Position: Chr9, Syntenic
|
| Alliance: |
Igs7tm175(tetO-EGFP/RNAi:Pou5f1,CAG-tdTomato,-tTA2)Tasic page
|
|
| Allele Type: |
|
Targeted (Conditional ready, Inducible, Reporter, Transactivator) |
| Inducer: |
|
doxycycline/tetracycline |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: The vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Pou5f1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP.
The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO.
The EGFP/RNAi:Pouf5f1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~140bp linker sequence and a 121bp short hairpin RNA sequence (gaaggtatattgctgttgacagtgagcgacagaaggagctag aacagttttagtgaagccacagatgtaaaactgttctagctccttctgctgcctactgcctcggacttcaaggggctag) designed to target/silence the mouse octamer-binding transcription factor 4 encoding locus (Pou5f1).
(J:101977)
|
|
|