About   Help   FAQ
Igs7tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic
Targeted Allele Detail
Summary
Symbol: Igs7tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic
Name: intergenic site 7; targeted mutation 174, Bosiljka Tasic
MGI ID: MGI:6514369
Synonyms: Ai174, Igs7tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Hze
Gene: Igs7  Location: unknown  Genetic Position: Chr9, Syntenic
Alliance: Igs7tm174(tetO-EGFP/RNAi:Hdac1,CAG-tdTomato,-tTA2)Tasic page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:101977
Parent Cell Line:  G4 (ES Cell)
Strain of Origin:  (129S6/SvEvTac x C57BL/6NCrl)F1
Mutation
description
Allele Type:    Targeted (Conditional ready, Inducible, Reporter, Transactivator)
Inducer:    doxycycline/tetracycline
Mutation:    Insertion
 
Mutation detailsThe vector is designed with (from 5' to 3') an FRT3 site, two copies of chicken beta-globin HS4 insulator element (to reduce reporter gene expression in absence of transactivators), a Tet response element/promoter (TRE2; details below), a loxP-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-PGKpA), an EGFP/RNAi:Hdac1 fusion protein (described below), a woodchuck hepatitis virus post-transcriptional regulatory element, a BGH polyA, two copies of chicken beta-globin HS4 insulator element, a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter, a lox2272-flanked STOP cassette (stop codons in all three reading frames linked to synthetic pA-hGHpA-TKpA), a tdTomato sequence, a viral 2A oligopeptide), a synthetic modified tetracycline-regulated transactivator gene (tTA2(S)), a WPRE, a BGH polyA, an AttB site, a PGK-5'hygro cassette, an RNA splice donor, a FRT5 site, SA, 3'hygro, SV40pA, and AttP. The TRE2 promoter used here is Tet-responsive P>hCMV*-1<; containing the Tet response element (seven copies of the 19 bp tet operator sequence [tetO]) just upstream of a minimal cytomegalovirus promoter (P>min CMV<), which lacks the enhancer that is part of the complete CMV promoter. Consequently, P>hCMV*-1< is silent in the absence of tTA or rtTA binding to tetO. The EGFP/RNAi:HDAC1 fusion protein is composed of a synthetic enhanced green fluorescent protein sequence (EGFP), an ~150bp linker sequence and a 97bp short hairpin RNA sequence (tgctgttgacagtgagcgagcttgggtaatagcagccatttagtgaagccacagatgtaaatggctgctattacccaagcctgcctactgcctcgga) designed to target/silence the mouse histone deacetylase 1 locus (Hdac1). (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Igs7 Mutation:  76 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory