Usp28^em1Baz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp28^em1Baz
• Name: ubiquitin specific peptidase 28; endonuclease-mediated mutation 1, Hisham Bazzi
• MGI ID: MGI:6510239
• Gene: Usp28 Location: Chr9:48896675-48953817 bp, + strand Genetic Position: Chr9, 26.56 cM
• Alliance: Usp28^em1Baz page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: CRISPR/Cas9 technology generated a 1 bp insertion in exon 2 (AATCAGCTGCGAGAAATCAC to AATCAGCTGCGAGAAATTCAC) using the gRNA AATCAGCTGCGAGAAATCAC. (J:302304)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Usp28 Mutation: 79 strains or lines available

References

• Original: J:302304 Xiao C, et al., Gradual centriole maturation associates with the mitotic surveillance pathway in mouse development. EMBO Rep. 2021 Feb 3;22(2):e51127
• All: 1 reference(s)