Trp53bp1^em1Baz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53bp1^em1Baz
• Name: transformation related protein 53 binding protein 1; endonuclease-mediated mutation 1, Hisham Bazzi
• MGI ID: MGI:6510238
• Synonyms: 53bp1^-
• Gene: Trp53bp1 Location: Chr2:121023762-121101888 bp, - strand Genetic Position: Chr2, 60.37 cM
• Alliance: Trp53bp1^em1Baz page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: CRISPR/Cas9 technology generated a 5 bp deletion and a 4 bp insertion (TCTTCTCATTTGGGTACCAG to TCTTCTCATTTGTTCT-CAG) in exon 4 using the gRNA TCTTCTCATTTGGGTACCAG. (J:302304)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trp53bp1 Mutation: 100 strains or lines available

References

• Original: J:302304 Xiao C, et al., Gradual centriole maturation associates with the mitotic surveillance pathway in mouse development. EMBO Rep. 2021 Feb 3;22(2):e51127
• All: 1 reference(s)