About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Nlrc4em2Vnce
Name: NLR family, CARD domain containing 4; endonuclease-mediated mutation 2, Russell Vance
MGI ID: MGI:6508702
Synonyms: Nlrc4em2(S533A)Vnce, Nlrc4S533A
Gene: Nlrc4  Location: Chr17:74733254-74766140 bp, - strand  Genetic Position: Chr17, 45.64 cM
Strain of Origin:  C57BL/6J
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
Mutation detailsSerine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to alanine codon GCA (p.S533A). This mutation renders the encoded peptide nonphosphorylatable at this residue. Western blot experiments confirmed the expression of peptides from this allele. (J:294930)
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nlrc4 Mutation:  46 strains or lines available
Original:  J:294930 Tenthorey JL, et al., NLRC4 inflammasome activation is NLRP3- and phosphorylation-independent during infection and does not protect from melanoma. J Exp Med. 2020 Jul 6;217(7)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.17
The Jackson Laboratory