About   Help   FAQ
Gt(ROSA)26Sorem1(CAG-tdTomato)Jahe
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Gt(ROSA)26Sorem1(CAG-tdTomato)Jahe
Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jason Heaney
MGI ID: MGI:6507752
Synonyms: Ai9-SauSpyCas9
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Mutation
origin
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Reporter)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. (J:302103)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  741 strains or lines available
Notes
This allele was generated from Gt(ROSA)26Sortm9(CAG-tdTomato)Hze.
References
Original:  J:302103 Heaney J, Direct data submission of a CRISPR-modified Ai9 allele. MGI Direct Data Submission. 2020;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory