Bin1^em1Aduci
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bin1^em1Aduci
• Name: bridging integrator 1; endonuclease-mediated mutation 1, Frank LaFerla
• MGI ID: MGI:6501985
• Synonyms: BIN1^K358R
• Gene: Bin1 Location: Chr18:32510283-32568790 bp, + strand Genetic Position: Chr18, 18.01 cM
• Alliance: Bin1^em1Aduci page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Guide RNA (GATGAGCTGCAACTCAAAGC) is designed to create an AAA to AGG missense mutation resulting in a lysine to arginine change at amino acid 537 (K537R). The K537R mutation is homologous to the human K542R SNP which has been shown to correlate with increased risk of sporadic Alzheimer's disease. One silent DNA mutation was also introduced. (J:350695)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Bin1 Mutation: 29 strains or lines available

References

• Original: J:350695 Garcia-Agudo LF, et al., BIN1(K358R) suppresses glial response to plaques in mouse model of Alzheimer's disease. Alzheimers Dement. 2024 Apr;20(4):2922-2942
• All: 1 reference(s)