Rnf183^em1Kaim
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rnf183^em1Kaim
• Name: ring finger protein 183; endonuclease-mediated mutation 1, Kazunori Imaizumi
• MGI ID: MGI:6488086
• Synonyms: RNF183-GFP
• Gene: Rnf183 Location: Chr4:62345777-62353487 bp, - strand Genetic Position: Chr4, 33.13 cM
• Alliance: Rnf183^em1Kaim page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: The GFP fluorescent marker gene and linker sequence was inserted upstream of the coding region in exon 3 using a donor plasmid, a crRNA (CAGAGGAUGAGCGAACCACAGUUUUAGAGCUAUGCUGUUUUG) and a tracrRNA (AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU) with CRISPR/Cas9 technology. (J:291079)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rnf183 Mutation: 13 strains or lines available

References

• Original: J:291079 Maeoka Y, et al., Renal medullary tonicity regulates RNF183 expression in the collecting ducts via NFAT5. Biochem Biophys Res Commun. 2019 Jun 25;514(2):436-442
• All: 1 reference(s)