Cfap58^em1Fzh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cfap58^em1Fzh
• Name: cilia and flagella associated protein 58; endonuclease-mediated mutation 1, Feng Zhang
• MGI ID: MGI:6477396
• Synonyms: Cfap58-KO
• Gene: Cfap58 Location: Chr19:47926151-48023818 bp, + strand Genetic Position: Chr19, 40.6 cM
• Alliance: Cfap58^em1Fzh page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Exon 10 was targeted with sgRNAs (CTGATCTCACAGCTTCATAC and GAACCTGTACAGCAAAAACC) using CRISPR/Cas9 technology, resulting in a 13bp/3bp deletion/insertion. Immunoblot experiments confirmed virtual absence of protein expression from this allele. (J:296991)

Disease models

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cfap58 Mutation: 53 strains or lines available

References

• Original: J:296991 He X, et al., Bi-allelic Loss-of-function Variants in CFAP58 Cause Flagellar Axoneme and Mitochondrial Sheath Defects and Asthenoteratozoospermia in Humans and Mice. Am J Hum Genet. 2020 Sep 3;107(3):514-526
• All: 1 reference(s)