Tns2^em2Nsas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tns2^em2Nsas
• Name: tensin 2; endonuclease-mediated mutation 2, Nobuya Sasaki
• MGI ID: MGI:6471943
• Synonyms: Tns2^C231S, Tns2^CS
• Gene: Tns2 Location: Chr15:102008848-102024836 bp, + strand Genetic Position: Chr15, 57.29 cM
• Alliance: Tns2^em2Nsas page

Mutation origin

• Strain of Origin: FVB

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: Cysteine codon 231 (TGC) in exon 9 was changed to serine (AGC) (p.C231S) using an sgRNA (targeting CGTGGTTGTGTTGTACTGCA ) and an ssODN template with CRISPR/Cas9 technology. (J:296747)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tns2 Mutation: 116 strains or lines available

References

• Original: J:296747 Sasaki H, et al., Deletion of the Tensin2 SH2-PTB domain, but not the loss of its PTPase activity, induces podocyte injury in FVB/N mouse strain. Exp Anim (Tokyo). 2020;69(2):135-143
• All: 2 reference(s)