Roraem1Litt
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Roraem1Litt |
| Name: |
RAR-related orphan receptor alpha; endonuclease-mediated mutation 1, Dan R LIttman |
| MGI ID: |
MGI:6467242 |
| Synonyms: |
Rora-TS |
| Gene: |
Rora Location: Chr9:68561068-69295528 bp, + strand Genetic Position: Chr9, 37.45 cM
|
| Alliance: |
Roraem1Litt page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: CRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon immediately before the stop codon. TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rora exon: CGGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAATTGTTCACTTCAGAATTTGAGCCAGCTATGCAGATTGACGGA] gcaagcggatcggcttcaggatcggcctct TGGTCTCACCCACAGTTCGAGAAG ggaggcggatccggaggtgggtctggcggatccgct TGGTCCCATCCTCAGTTTGAAAAG [TAA stop].
(J:336987)
|
|
|
|
|
| Original: |
J:336987 Hall JA, et al., Transcription factor RORalpha enforces stability of the Th17 cell effector program by binding to a Rorc cis-regulatory element. Immunity. 2022 Nov 8;55(11):2027-2043.e9 |
| All: |
1 reference(s) |
|