About   Help   FAQ
Roraem1Litt
Endonuclease-mediated Allele Detail
Summary
Symbol: Roraem1Litt
Name: RAR-related orphan receptor alpha; endonuclease-mediated mutation 1, Dan R LIttman
MGI ID: MGI:6467242
Synonyms: Rora-TS
Gene: Rora  Location: Chr9:68561068-69295528 bp, + strand  Genetic Position: Chr9, 37.45 cM
Alliance: Roraem1Litt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Insertion
 
Mutation detailsCRISPR/cas9 genome editing is used to introduce twin-strep (TS) tag sequence into the last exon immediately before the stop codon. TS tag encodes two tandem streptavidin-binding peptides (upper case) that are preceded and separated by linker (lower case) sequences: [Last Rora exon: CGGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTCCATTTTCCTCCATTATACAAGGAATTGTTCACTTCAGAATTTGAGCCAGCTATGCAGATTGACGGA] gcaagcggatcggcttcaggatcggcctct TGGTCTCACCCACAGTTCGAGAAG ggaggcggatccggaggtgggtctggcggatccgct TGGTCCCATCCTCAGTTTGAAAAG [TAA stop]. (J:336987)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rora Mutation:  43 strains or lines available
References
Original:  J:336987 Hall JA, et al., Transcription factor RORalpha enforces stability of the Th17 cell effector program by binding to a Rorc cis-regulatory element. Immunity. 2022 Nov 8;55(11):2027-2043.e9
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory