About   Help   FAQ
Unc93b1em1Gbrt
Endonuclease-mediated Allele Detail
Summary
Symbol: Unc93b1em1Gbrt
Name: unc-93 homolog B1, TLR signaling regulator; endonuclease-mediated mutation 1, Greg Barton
MGI ID: MGI:6466696
Synonyms: Unc93b1S282A
Gene: Unc93b1  Location: Chr19:3985222-3999340 bp, + strand  Genetic Position: Chr19, 3.65 cM
Alliance: Unc93b1em1Gbrt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutations:    Insertion, Nucleotide substitutions
 
Mutation detailsCRISPR/Cas9 genome editing is used to create a guide RNA (TGCTGCGCGGCAGCGTCCGAAGG) designed to change AGC to GCC, resulting in a serine to alanine change at mouse amino acid 303, analogous to amino acid 282 in humans. Since this gene has two start sites, this amino acid would be S303A when cloned from the first alternative start site (MKEVPT). It is unknown if there are any off-target sites present. The mutation was confirmed by sequencing. (J:287503)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Unc93b1 Mutation:  41 strains or lines available
References
Original:  J:287503 Majer O, et al., Release from UNC93B1 reinforces the compartmentalized activation of select TLRs. Nature. 2019 Nov;575(7782):371-374
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory