Unc93b1^em1Gbrt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Unc93b1^em1Gbrt
• Name: unc-93 homolog B1, TLR signaling regulator; endonuclease-mediated mutation 1, Greg Barton
• MGI ID: MGI:6466696
• Synonyms: Unc93b1^S282A
• Gene: Unc93b1 Location: Chr19:3985222-3999340 bp, + strand Genetic Position: Chr19, 3.65 cM
• Alliance: Unc93b1^em1Gbrt page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutations: Insertion, Nucleotide substitutions
• Mutation details: CRISPR/Cas9 genome editing is used to create a guide RNA (TGCTGCGCGGCAGCGTCCGAAGG) designed to change AGC to GCC, resulting in a serine to alanine change at mouse amino acid 303, analogous to amino acid 282 in humans. Since this gene has two start sites, this amino acid would be S303A when cloned from the first alternative start site (MKEVPT). It is unknown if there are any off-target sites present. The mutation was confirmed by sequencing. (J:287503)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Unc93b1 Mutation: 41 strains or lines available

References

• Original: J:287503 Majer O, et al., Release from UNC93B1 reinforces the compartmentalized activation of select TLRs. Nature. 2019 Nov;575(7782):371-374
• All: 1 reference(s)