Tmieem2Mll
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmieem2Mll |
| Name: |
transmembrane inner ear; endonuclease-mediated mutation 2, Ulrich Muller |
| MGI ID: |
MGI:6452851 |
| Synonyms: |
Tmie-3X-MYC |
| Gene: |
Tmie Location: Chr9:110694755-110709141 bp, - strand Genetic Position: Chr9, 60.79 cM
|
| Alliance: |
Tmieem2Mll page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Epitope tag) |
| Mutation: |
|
Insertion
|
| |
|
Mutation details: Using CRISPR/Cas9 technology, sequence 5'-GGCGGCAGCGGCGAGCAGAAACTCATCTCTGAAGAAGATCTGGAACAAAAGTTGATTTCAGAAGAAGATC TGGAACAGAAGCTCATCTCTGAGGAAGATCTG-3', encoding GGSGEQKLISEEDLEQKLISEEDLEQKLISEEDL, was inserted immediately before the endogenous stop codon, providing the encoded peptide with three copies of a MYC tag linked via a 4 amino-acid linker to the C-terminus.
(J:293413)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Tmie Mutation: |
15 strains or lines available
|
|
| Original: |
J:293413 Cunningham CL, et al., TMIE Defines Pore and Gating Properties of the Mechanotransduction Channel of Mammalian Cochlear Hair Cells. Neuron. 2020 Jul 8;107(1):126-143.e8 |
| All: |
1 reference(s) |
|