About   Help   FAQ
Tmieem2Mll
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmieem2Mll
Name: transmembrane inner ear; endonuclease-mediated mutation 2, Ulrich Muller
MGI ID: MGI:6452851
Synonyms: Tmie-3X-MYC
Gene: Tmie  Location: Chr9:110694755-110709141 bp, - strand  Genetic Position: Chr9, 60.79 cM
Alliance: Tmieem2Mll page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Epitope tag)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR/Cas9 technology, sequence 5'-GGCGGCAGCGGCGAGCAGAAACTCATCTCTGAAGAAGATCTGGAACAAAAGTTGATTTCAGAAGAAGATC TGGAACAGAAGCTCATCTCTGAGGAAGATCTG-3', encoding GGSGEQKLISEEDLEQKLISEEDLEQKLISEEDL, was inserted immediately before the endogenous stop codon, providing the encoded peptide with three copies of a MYC tag linked via a 4 amino-acid linker to the C-terminus. (J:293413)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tmie Mutation:  15 strains or lines available
References
Original:  J:293413 Cunningham CL, et al., TMIE Defines Pore and Gating Properties of the Mechanotransduction Channel of Mammalian Cochlear Hair Cells. Neuron. 2020 Jul 8;107(1):126-143.e8
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory