Tmie^em2Mll
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmie^em2Mll
• Name: transmembrane inner ear; endonuclease-mediated mutation 2, Ulrich Muller
• MGI ID: MGI:6452851
• Synonyms: Tmie-3X-MYC
• Gene: Tmie Location: Chr9:110694755-110709141 bp, - strand Genetic Position: Chr9, 60.79 cM
• Alliance: Tmie^em2Mll page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Epitope tag)
• Mutation: Insertion
• Mutation details: Using CRISPR/Cas9 technology, sequence 5'-GGCGGCAGCGGCGAGCAGAAACTCATCTCTGAAGAAGATCTGGAACAAAAGTTGATTTCAGAAGAAGATC TGGAACAGAAGCTCATCTCTGAGGAAGATCTG-3', encoding GGSGEQKLISEEDLEQKLISEEDLEQKLISEEDL, was inserted immediately before the endogenous stop codon, providing the encoded peptide with three copies of a MYC tag linked via a 4 amino-acid linker to the C-terminus. (J:293413)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tmie Mutation: 15 strains or lines available

References

• Original: J:293413 Cunningham CL, et al., TMIE Defines Pore and Gating Properties of the Mechanotransduction Channel of Mammalian Cochlear Hair Cells. Neuron. 2020 Jul 8;107(1):126-143.e8
• All: 1 reference(s)