Trmt9b^em2H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trmt9b^em2H
• Name: tRNA methyltransferase 9B; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6451748
• Synonyms: TRMT9B-FLOX-EM2-B6N
• Gene: Trmt9b Location: Chr8:36924643-36981738 bp, + strand Genetic Position: Chr8, 23.05 cM
• Alliance: Trmt9b^em2H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CTTGCATGTAGCGAAACACA, GCTATTAACCTAAGAATGTG, TGTTTCGCTACATGCAAGAA, and TTAGGTTAATAGCAGGTACA. This resulted in deletion(s) of 49 bp (location: Chr8:36973104-36973152; GRCm39), 79 bp (location: Chr8:36972151-36972229; GRCm39) and insertions of 63 bp (location: chr8:36972150; GRCm39), 62 bp (location: chr8:36973153; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trmt9b Mutation: 31 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)