Prdm8^em1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prdm8^em1H
• Name: PR domain containing 8; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6451733
• Synonyms: PRDM8-FLOX-EM1-B6N
• Gene: Prdm8 Location: Chr5:98315241-98335313 bp, + strand Genetic Position: Chr5, 47.77 cM, cytoband E3
• Alliance: Prdm8^em1H page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences CGAATGGAACTAGGACAGAA, CTGAATCGGTACTCTAGTTC, GTGTTGTCCCGAATGGAACT, and GTTCTGGGTTCCCTAGATTA that targeted exon(s) ENSMUSE00000504604.6 ENSMUSE00001354819.2. This resulted in deletion(s) of 20 bp (location: Chr5:98332610-98332629; GRCm39), 31 bp (location: Chr5:98331578-98331608; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prdm8 Mutation: 21 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)