Cx3cl1^em1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cx3cl1^em1H
• Name: C-X3-C motif chemokine ligand 1; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6451422
• Synonyms: CX3CL1-FLOX-EM1-B6N
• Gene: Cx3cl1 Location: Chr8:95498808-95509055 bp, + strand Genetic Position: Chr8, 46.79 cM
• Alliance: Cx3cl1^em1H page

Mutation origin

• Strain of Origin: C57BL/6NTac

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 4 guides with spacer sequences CAATGCCGTAGGGGTGGAAC, CATAGCGGGGAGAGGAATCT, and TGGATGGCTCACCGTGGTTC that targeted exon(s) ENSMUSE00001390177.2. This resulted in deletion(s) of 54 bp (location: Chr8:95504962-95505015; GRCm39), 54 bp (location: Chr8:95504962-95505015; GRCm39), 76 bp (location: Chr8:95504176-95504251; GRCm39), and 76 bp (location: Chr8:95504176-95504251; GRCm39) and insertions of 63 bp (location: chr8:95504175; GRCm39), 62 bp (location: chr8:95505016; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cx3cl1 Mutation: 35 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 3 reference(s)