Cntnap2^em3H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cntnap2^em3H
• Name: contactin associated protein-like 2; endonuclease-mediated mutation 3, Harwell
• MGI ID: MGI:6451417
• Synonyms: CNTNAP2-FLOX-EM3-B6
• Gene: Cntnap2 Location: Chr6:45036995-47278330 bp, + strand Genetic Position: Chr6, 21.81 cM, cytoband B2
• Alliance: Cntnap2^em3H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGCTCTCTAGATTAGCAGAA, CAAACTTAGTGTATGCTAGG, GAACAAACTTAGTGTATGCT, and GAGAACCCCATCTTTGACTC. This resulted in deletion(s) of 57 bp (location: Chr6:45898029-45898085; GRCm39), 60 bp (location: Chr6:45897366-45897425; GRCm39) and insertions of 63 bp (location: chr6:45897365; GRCm39), 62 bp (location: chr6:45898089; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cntnap2 Mutation: 95 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)