Samsn1^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Samsn1^em1(IMPC)Ics
• Name: SAM domain, SH3 domain and nuclear localization signals, 1; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6451107
• Gene: Samsn1 Location: Chr16:75655682-75706154 bp, - strand Genetic Position: Chr16, 43.36 cM
• Alliance: Samsn1^em1(IMPC)Ics page
• IMPC: Samsn1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences AACAGTGAATGCTCACTCTG, ACAGTGAATGCTCACTCTGA, CAGATCAGTTTTCCACAGAC, and GCACACAGTGAACCTGTCTG that targeted exon(s) ENSMUSE00000617561.2. This resulted in deletion(s) of 259 bp (location: Chr16:75675907-75676165; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Samsn1 Mutation: 27 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)