About   Help   FAQ
Ripk1em2Hbz
Endonuclease-mediated Allele Detail
Summary
Symbol: Ripk1em2Hbz
Name: receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 2, Haibing Zhang
MGI ID: MGI:6449646
Synonyms: Rip1delta
Gene: Ripk1  Location: Chr13:34186346-34221130 bp, + strand  Genetic Position: Chr13, 14.01 cM
Alliance: Ripk1em2Hbz page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 genome editing technology was used with an sgRNA targeting GACCTAGACAGCGGAGGCTT and an ssODN template to delete a 6 bp sequence, resulting in the deletion of two highly conserved amino acids, F28 and G29, from the P-loop of the N-terminal kinase domain of the encoded protein. (J:268414)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ripk1 Mutation:  32 strains or lines available
References
Original:  J:268414 Liu Y, et al., RIP1 kinase activity-dependent roles in embryonic development of Fadd-deficient mice. Cell Death Differ. 2017 Aug;24(8):1459-1469
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory