Ripk1^em2Hbz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ripk1^em2Hbz
• Name: receptor (TNFRSF)-interacting serine-threonine kinase 1; endonuclease-mediated mutation 2, Haibing Zhang
• MGI ID: MGI:6449646
• Synonyms: Rip1^delta
• Gene: Ripk1 Location: Chr13:34186346-34221130 bp, + strand Genetic Position: Chr13, 14.01 cM
• Alliance: Ripk1^em2Hbz page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 genome editing technology was used with an sgRNA targeting GACCTAGACAGCGGAGGCTT and an ssODN template to delete a 6 bp sequence, resulting in the deletion of two highly conserved amino acids, F28 and G29, from the P-loop of the N-terminal kinase domain of the encoded protein. (J:268414)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ripk1 Mutation: 32 strains or lines available

References

• Original: J:268414 Liu Y, et al., RIP1 kinase activity-dependent roles in embryonic development of Fadd-deficient mice. Cell Death Differ. 2017 Aug;24(8):1459-1469
• All: 2 reference(s)