Phf3em1(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Phf3em1(IMPC)H |
Name: |
PHD finger protein 3; endonuclease-mediated mutation 1, Harwell |
MGI ID: |
MGI:6449049 |
Gene: |
Phf3 Location: Chr1:30841417-30912989 bp, - strand Genetic Position: Chr1, 11.45 cM
|
Alliance: |
Phf3em1(IMPC)H page
|
IMPC: |
Phf3 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences CCAGTCCTGAGGCAGCATAACAA, CCTATACTATTCCTATGCGAGTA, CCCTATACTATTCCTATGCGAGT, CCTGAGGCAGCATAACAATTCTG, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Phf3 Mutation: |
103 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
2 reference(s) |
|