Mecp2^em7.1Bird
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mecp2^em7.1Bird
• Name: methyl CpG binding protein 2; endonuclease-mediated mutation 7.1, Adrian Bird
• MGI ID: MGI:6437877
• Synonyms: MM2-EGFP
• Gene: Mecp2 Location: ChrX:73070198-73129296 bp, - strand Genetic Position: ChrX, 37.63 cM
• Alliance: Mecp2^em7.1Bird page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:309631
• Parent Cell Line: E14TG2a.4 (ES Cell)
• Strain of Origin: 129P2/OlaHsd

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: CRIPSPR-targeting replaced the sequence encoding the methyl-CpG binding domain (MBD) of Mecp2 (NCBI NM_010788 c. 280-492 and intron 3; p. 94-164) with the homologous sequence from MBD2 (NCBI NM_010773 c. 457-651, excluding the intron; p. 153-217). The gene was tagged at the C-terminus by EGFP connected with a short linker (TGTAAGGATCCACCGGTCGCCACC). Cre-mediated recombination removed the selection cassette in intron 2. (J:309631)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mecp2 Mutation: 46 strains or lines available

References

• Original: J:309631 Tillotson R, et al., Neuronal non-CG methylation is an essential target for MeCP2 function. Mol Cell. 2021 Mar 18;81(6):1260-1275.e12
• All: 1 reference(s)