Kcnc1^em4(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnc1^em4(IMPC)H
• Name: potassium voltage gated channel, Shaw-related subfamily, member 1; endonuclease-mediated mutation 4, Harwell
• MGI ID: MGI:6437754
• Gene: Kcnc1 Location: Chr7:46045921-46088128 bp, + strand Genetic Position: Chr7, 30.1 cM
• Alliance: Kcnc1^em4(IMPC)H page
• IMPC: Kcnc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AGAAGAACTCGTCGGCACGC and CACGCGGGTCATAGTCGAAG that targeted exon(s) ENSMUSE00000505576.4 ENSMUSE00000634676.3. This resulted in deletion(s) of 7 bp (location: Chr7:46047250-46047256; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kcnc1 Mutation: 42 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)