Purgem1(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Purgem1(IMPC)H |
| Name: |
purine-rich element binding protein G; endonuclease-mediated mutation 1, Harwell |
| MGI ID: |
MGI:6437752 |
| Gene: |
Purg Location: Chr8:33876353-33907495 bp, + strand Genetic Position: Chr8, 20.3 cM
|
| Alliance: |
Purgem1(IMPC)H page
|
| IMPC: |
Purg gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences TATCTTTAGGAAGCGGCCCC and TCCTAAAGATAGCCGAAGTC that targeted exon(s) ENSMUSE00000492265.5 ENSMUSE00000498194.3 ENSMUSE00001883199.1 ENSMUSE00001883696.1 ENSMUSE00001883702.1 ENSMUSE00001883709.1 ENSMUSE00001883710.1. This resulted in deletion(s) of 17 bp (location: Chr8:33876603-33876619; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
3 reference(s) |
|