About   Help   FAQ
Ms4a4dem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ms4a4dem1(IMPC)J
Name: membrane-spanning 4-domains, subfamily A, member 4D; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6432397
Gene: Ms4a4d  Location: Chr19:11514165-11535831 bp, + strand  Genetic Position: Chr19, 8.44 cM, cytoband B
Alliance: Ms4a4dem1(IMPC)J page
IMPC: Ms4a4d gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AATGCTACATTCCCATTTAA and ATGGCGGGATGCCATGGAGG, which resulted in a 6557 bp deletion beginning at Chromosome 19 position 11,548,405 bp and ending after 11,554,961 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000991798, ENSMUSE00000985830, ENSMUSE00001086305, ENSMUSE00000144349 (exons 2,3,4,5) and 6097 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. There is a 3 bp deletion (ATT) 24 bp before the larger deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ms4a4d Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory