Gid8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gid8^em1(IMPC)J
• Name: GID complex subunit 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6414761
• Gene: Gid8 Location: Chr2:180351910-180360526 bp, + strand Genetic Position: Chr2, 103.26 cM, cytoband H4
• Alliance: Gid8^em1(IMPC)J page
• IMPC: Gid8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGATGCCAGAGCAACAG and GCGCTGCTCTTCCTCTCACA, which resulted in a 2882 bp deletion beginning at Chromosome 2 position 180,714,342 bp and ending after 180,717,223 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170682 and ENSMUSE00000170684 (exons 2 and 3) and 2487 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 39 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gid8 Mutation: 58 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)