Cpsf6^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cpsf6^{em1(IMPC)Hmgu}
• Name: cleavage and polyadenylation specific factor 6; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6414541
• Gene: Cpsf6 Location: Chr10:117180572-117212903 bp, - strand Genetic Position: Chr10, 65.41 cM
• Alliance: Cpsf6^{em1(IMPC)Hmgu} page
• IMPC: Cpsf6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 3 guide sequences CCCAAACATTCAGCAGCGAGCGG, GAAACTACAGCCCGCCAATATGG, CCACTACACTAGCGGAGATAGAG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cpsf6 Mutation: 31 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)