About   Help   FAQ
Arap1em1Ciphe
Endonuclease-mediated Allele Detail
Summary
Symbol: Arap1em1Ciphe
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
MGI ID: MGI:6406675
Gene: Arap1  Location: Chr7:100997296-101061793 bp, + strand  Genetic Position: Chr7, 54.56 cM, cytoband F1
Alliance: Arap1em1Ciphe page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsIntron 19 and exon 21 were targeted with sgRNAs (targeting TATGGGTCATGAATAAGGCCTGG and TGTACATCCAGGGTGAGCGGCGG) using CRISPR/Cas9 technology, resulting in a 222bp deletion encompassing exon 20 and a 5' part of exon 21. (J:82809, J:282407)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arap1 Mutation:  77 strains or lines available
References
Original:  J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory