Cdkn2aip^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdkn2aip^em1(IMPC)J
• Name: CDKN2A interacting protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403878
• Gene: Cdkn2aip Location: Chr8:48162379-48166966 bp, - strand Genetic Position: Chr8, 26.88 cM
• Alliance: Cdkn2aip^em1(IMPC)J page
• IMPC: Cdkn2aip gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTGAGGATGTTTCAGTGC and TCTACGGCTCGTTTTTTGGA, which resulted in a 1262 bp deletion beginning at Chromosome 8 position 47,711,014 bp and ending after 47,712,275 bp (GRCm38/mm10). This mutation deletes 1262 bp from ENSMUSE00001390013 (exon 3) and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdkn2aip Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)