Mbtps2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mbtps2^em1(IMPC)J
• Name: membrane-bound transcription factor peptidase, site 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403850
• Gene: Mbtps2 Location: ChrX:156330818-156381711 bp, - strand Genetic Position: ChrX, 72.55 cM
• Alliance: Mbtps2^em1(IMPC)J page
• IMPC: Mbtps2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACAAACGATTACATCACT and TTTTACGGTTTCCTTTAAAT, which resulted in a 329 bp deletion beginning at Chromosome X position 157,575,872 bp and ending after 157,576,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220470 (exon 4) and 225 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mbtps2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)