Zfp286^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp286^em1(IMPC)J
• Name: zinc finger protein 286; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402725
• Gene: Zfp286 Location: Chr11:62643403-62680288 bp, - strand Genetic Position: Chr11, 38.68 cM
• Alliance: Zfp286^em1(IMPC)J page
• IMPC: Zfp286 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCTTTGATGTCGGATGA and TGACTCCTTGCTCTCAGGTC, which resulted in a 1168 bp deletion beginning at Chromosome 11 position 62,779,722 bp and ending after 62,780,889 bp (GRCm38/mm10). This mutation deletes 1168 bp of ENSMUSE00000355028 (exon 4) and is predicted to cause a change of amino acid sequence after residue 119 and termination 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp286 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)