About   Help   FAQ
Tbccem1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Tbccem1(IMPC)J
Name: tubulin-specific chaperone C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6401486
Gene: Tbcc  Location: Chr17:47201610-47202773 bp, + strand  Genetic Position: Chr17, 22.9 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGCGAGGAGAATATGGA and ACGCTGTCATACTCAAAGGG, which resulted in a 1313 bp deletion beginning at Chromosome 17 position 46,890,571 bp and ending after 46,891,883 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323360 (exon 1) and 149 bp of flanking intronic sequence including the splice acceptor, donor and start site is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tbcc Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/12/2022
MGI 6.17
The Jackson Laboratory