Cldn9em2(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Cldn9em2(IMPC)H |
Name: |
claudin 9; endonuclease-mediated mutation 2, Harwell |
MGI ID: |
MGI:6400924 |
Gene: |
Cldn9 Location: Chr17:23901558-23903000 bp, - strand Genetic Position: Chr17, 11.99 cM, cytoband A3.3
|
Alliance: |
Cldn9em2(IMPC)H page
|
IMPC: |
Cldn9 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences CCTGCGGTGAGTACGATACGGGC, CCCCTGCGGTGAGTACGATACGG, which resulted in a Indel.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Cldn9 Mutation: |
9 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|