About   Help   FAQ
Dmtf1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dmtf1lem1(IMPC)J
Name: cyclin D binding myb like transcription factor 1 like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6393702
Gene: Dmtf1l  Location: ChrX:125720085-125723491 bp, - strand  Genetic Position: ChrX, 49.81 cM
Alliance: Dmtf1lem1(IMPC)J page
IMPC: Dmtf1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACTGTGGTCCAGTGGGCA and GAGCTCTGTCTTACTTAGTG, which resulted in a 1381 bp deletion beginning at Chromosome X position 126,814,082 bp and ending after 126,815,466 bp (GRCm38/mm10). This mutation deletes 1381 bp of ENSMUSE00001029817 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. There is a 4 bp insertion (ACCA) at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dmtf1l Mutation:  3 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory