Clcn2^tm3.1Tjj
Targeted Allele Detail

Summary

• Symbol: Clcn2^tm3.1Tjj
• Name: chloride channel, voltage-sensitive 2; targeted mutation 3.1, Thomas J Jentsch
• MGI ID: MGI:6393527
• Synonyms: Clcn2^op
• Gene: Clcn2 Location: Chr16:20521714-20536496 bp, - strand Genetic Position: Chr16, 12.5 cM
• Alliance: Clcn2^tm3.1Tjj page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:281449
• Parent Cell Line: R1 (ES Cell)
• Strain of Origin: (129X1/SvJ x 129S1/Sv)F1-Kitl⁺

Mutation description

• Allele Type: Targeted (Not Applicable)
• Mutations: Insertion, Intragenic deletion
• Mutation details: An open mutation was generated by inserting an FRT-flanked neomyn cassette between exon 1 and 2, and deleting 24bp (TACACTCAGGAACTCGGGGCCTTT; aa sequence: YTQELGAF) from exon 2. An additional two amino acids (AK to IS; bp change: GCCAAA to ATATCA) deletion created an EcoRV site in exon 2. The modified exon 2 and exon 3 were also floxed to provide the capacity for generating a null allele. Flp-mediatd recombination removed the selection cassette. (J:281449)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Clcn2 Mutation: 39 strains or lines available

References

• Original: J:281449 Goppner C, et al., Pathogenesis of hypertension in a mouse model for human CLCN2 related hyperaldosteronism. Nat Commun. 2019 Oct 15;10(1):4678
• All: 2 reference(s)