About   Help   FAQ
Setbp1em8Lutzy
Endonuclease-mediated Allele Detail
Summary
Symbol: Setbp1em8Lutzy
Name: SET binding protein 1; endonuclease-mediated mutation 8, Cathy Lutz
MGI ID: MGI:6392173
Synonyms: Setbp1indel
Gene: Setbp1  Location: Chr18:78793595-79152606 bp, - strand  Genetic Position: Chr18, 52.67 cM, cytoband E3
Alliance: Setbp1em8Lutzy page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Deletion
 
Mutation detailsGuide RNAs [TCCCGATGCCACTGTCGCTC and GAGACTATCCCGAGCGACAG] were originally designed to introduce a point mutation in exon 4. DNA sequencing of the targeted region identified genome edited pups harboring a Setbp1 98-nt frameshift deletion (indel mutation) that starts at Pro-857 and introduces a TGA stop codon immediately afterwards [GCGAGGAGACTATCCC//del98//TTGACAACCCAGAGGCC]. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Setbp1 Mutation:  89 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory