Setbp1^em8Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Setbp1^em8Lutzy
• Name: SET binding protein 1; endonuclease-mediated mutation 8, Cathy Lutz
• MGI ID: MGI:6392173
• Synonyms: Setbp1^indel
• Gene: Setbp1 Location: Chr18:78793595-79152606 bp, - strand Genetic Position: Chr18, 52.67 cM, cytoband E3
• Alliance: Setbp1^em8Lutzy page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Deletion
• Mutation details: Guide RNAs [TCCCGATGCCACTGTCGCTC and GAGACTATCCCGAGCGACAG] were originally designed to introduce a point mutation in exon 4. DNA sequencing of the targeted region identified genome edited pups harboring a Setbp1 98-nt frameshift deletion (indel mutation) that starts at Pro-857 and introduces a TGA stop codon immediately afterwards [GCGAGGAGACTATCCC//del98//TTGACAACCCAGAGGCC]. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Setbp1 Mutation: 89 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)