About   Help   FAQ
Zic4em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Zic4em1(IMPC)H
Name: zinc finger protein of the cerebellum 4; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6390533
Gene: Zic4  Location: Chr9:91247636-91271404 bp, + strand  Genetic Position: Chr9, 48.26 cM
Alliance: Zic4em1(IMPC)H page
IMPC: Zic4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences CCCTGCACGGTTATGGCGGCATG, CCTGCACGGTTATGGCGGCATGA, which resulted in a Indel. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zic4 Mutation:  24 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory