Nkx1-2^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nkx1-2^em1(IMPC)H
• Name: NK1 homeobox 2; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6389080
• Gene: Nkx1-2 Location: Chr7:132197968-132201366 bp, - strand Genetic Position: Chr7, 76.3 cM
• Alliance: Nkx1-2^em1(IMPC)H page
• IMPC: Nkx1-2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences GCGCCTTGGCTTGGCGCAGCTGG, AGTGCGCGCGCGCCTTGGCTTGG, which resulted in a Indel. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nkx1-2 Mutation: 13 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)