Serpina7em2(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Serpina7em2(IMPC)J |
| Name: |
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7; endonuclease-mediated mutation 2, Jackson |
| MGI ID: |
MGI:6389076 |
| Gene: |
Serpina7 Location: ChrX:137980006-137985985 bp, - strand Genetic Position: ChrX, 61.23 cM, cytoband F1
|
| Alliance: |
Serpina7em2(IMPC)J page
|
| IMPC: |
Serpina7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from IMPC was generated at The Jackson Laboratory by injecting D10A RNA and 2 guide sequences GCAAAGTCAGCATTGATAGATGG, CCGATACAGACTGAATGCAAAGT, which resulted in a Indel.
(J:265051)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Serpina7 Mutation: |
5 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
1 reference(s) |
|