Cep120^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep120^em1(IMPC)J
• Name: centrosomal protein 120; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6389074
• Gene: Cep120 Location: Chr18:53814795-53877680 bp, - strand Genetic Position: Chr18, 29.07 cM
• Alliance: Cep120^em1(IMPC)J page
• IMPC: Cep120 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at The Jackson Laboratory by injecting D10A RNA and 2 guide sequences CCACGAGCAGATGCTTTGGACGT, CGTTTGGGGAAATGGCGACCTGG, which resulted in a Indel. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cep120 Mutation: 48 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)