Igsf5em1(IMPC)Ics
Endonuclease-mediated Allele Detail
|
Symbol: |
Igsf5em1(IMPC)Ics |
Name: |
immunoglobulin superfamily, member 5; endonuclease-mediated mutation 1, Mouse Clinical Institute |
MGI ID: |
MGI:6388387 |
Gene: |
Igsf5 Location: Chr16:96162868-96223321 bp, + strand Genetic Position: Chr16, 56.93 cM, cytoband C4
|
Alliance: |
Igsf5em1(IMPC)Ics page
|
IMPC: |
Igsf5 gene page |
|
Strain of Origin: |
C57BL/6N
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CCAGGGGTCTGTGTAACCGCAGG, CCTAGGACACGATGCCACAGAAG, CCTTAGGTATTCCCTCCAGGTGG, GATGAGCAAATGATGCAGTAGGG, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Igsf5 Mutation: |
23 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|