Prpf40b^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf40b^em1(IMPC)Ics
• Name: pre-mRNA processing factor 40B; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6388375
• Gene: Prpf40b Location: Chr15:99192968-99214899 bp, + strand Genetic Position: Chr15, 56.13 cM, cytoband F3
• Alliance: Prpf40b^em1(IMPC)Ics page
• IMPC: Prpf40b gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CCCACGCTGGATCATGCCTGTTG, TGTTAGTCGGCAGAGATCCCTGG, CCCTGGTCGGGGTGGAGGGAATA, TCCCCCCAGGCTCGGAGGTTGGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prpf40b Mutation: 34 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)