About   Help   FAQ
Kdrem1(IMPC)Ccpcz
Endonuclease-mediated Allele Detail
Summary
Symbol: Kdrem1(IMPC)Ccpcz
Name: kinase insert domain protein receptor; endonuclease-mediated mutation 1, Institute of Molecular Genetics
MGI ID: MGI:6388372
Gene: Kdr  Location: Chr5:76093487-76139118 bp, - strand  Genetic Position: Chr5, 40.23 cM
Alliance: Kdrem1(IMPC)Ccpcz page
IMPC: Kdr gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences GTGCTGTTGACCCTCCCTATGGG, TCTAAAGATGTGATCGAGGAGGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kdr Mutation:  71 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory