Sv2aem1(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Sv2aem1(IMPC)H |
Name: |
synaptic vesicle glycoprotein 2a; endonuclease-mediated mutation 1, Harwell |
MGI ID: |
MGI:6386303 |
Gene: |
Sv2a Location: Chr3:96088543-96102499 bp, + strand Genetic Position: Chr3, 41.65 cM, cytoband F2
|
Alliance: |
Sv2aem1(IMPC)H page
|
IMPC: |
Sv2a gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences AACATCCAGAATACCATGCGGGG, AGGTATCTAGGCGTCTAGGCAGG, TGAGTTAGGGATGAGTGTTCTGG, CCATGCGGGGTCTGTCCCCGAGT, which resulted in a Exon Deletion.
(J:265051)
|
Inheritance: |
|
Not Specified |
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Sv2a Mutation: |
36 strains or lines available
|
|
Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
All: |
1 reference(s) |
|