About   Help   FAQ
Zmynd10em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmynd10em1(IMPC)Tcp
Name: zinc finger, MYND domain containing 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6386302
Gene: Zmynd10  Location: Chr9:107424497-107428518 bp, + strand  Genetic Position: Chr9, 58.12 cM
Alliance: Zmynd10em1(IMPC)Tcp page
IMPC: Zmynd10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at The Centre for Phenogenomics by injecting CAS9 Protein, 2 guide sequences CCAAGGGCGGCCCTAGTTCTCCT, CTCCACCTTGTTCTGACGTCTGG, and a non-contributing oligo, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zmynd10 Mutation:  21 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory