Cstad^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cstad^em1(IMPC)J
• Name: CSA-conditional, T cell activation-dependent protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6383182
• Gene: Cstad Location: Chr2:30485056-30498957 bp, + strand Genetic Position: Chr2, 21.71 cM, cytoband B
• Alliance: Cstad^em1(IMPC)J page
• IMPC: Cstad gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCAGCTGAGCCATAACGG and TCATGAGTTGGTACAGCCAG, which resulted in a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10). This mutation deletes 228 bp from ENSMUSE00000662814 (exon 2) and is predicted to cause a change of amino acid sequence after residue 17 deletes 76 amino acids and remains in frame for the last 11 amino acids before the stop colon. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cstad Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)