About   Help   FAQ
Lysmd4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lysmd4em1(IMPC)J
Name: LysM, putative peptidoglycan-binding, domain containing 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6380682
Gene: Lysmd4  Location: Chr7:66872292-66878216 bp, + strand  Genetic Position: Chr7, 36.71 cM
Alliance: Lysmd4em1(IMPC)J page
IMPC: Lysmd4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATTCTGTGTCAGTATCAGG and ACAGCATTAGAGTAGCTGAC, which resulted in a 5123 bp deletion beginning at Chromosome 7 position 67,223,456 bp and ending after 67,228,578 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000466123 and ENSMUSE00001380362 (exons 2 and 3) and 2247 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted generate a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lysmd4 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory